Review



pcmv vsv g stewart  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Addgene inc pcmv vsv g stewart
    Pcmv Vsv G Stewart, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 3069 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcmv+vsv+g+stewart/pCMV-VSV-G+(Plasmid+%238454)/pm41915470-258-28-32
    Average 96 stars, based on 3069 article reviews
    pcmv vsv g stewart - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    other:

    Article Title: Acute multi-level response to defective de novo chromatin assembly in S-phase.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Agilent RNA 6000 Pico Kit Agilent Cat# 5067-1513 ViewRNA ISH Cell Assay Kit Invitrogen Cat# QVC0001 CellEvent Senescence Green Flow Cytometry Assay Kit Invitrogen Cat# C10840 Deposited data Raw and analyzed sequencing data This manuscript GEO: GSE262518 Proteomics data This manuscript PRIDE: PXD050618 Raw imaging data (microscopy and western blots) This manuscript https://doi.org/10.17632/n9h2mj7dbg.1 Custom scripts for data analysis This manuscript https://doi.org/10.5281/zenodo.13918157 Experimental models: Cell lines TERT-RPE-1 ATCC Cat# CRL-4000 HEK293T ATCC Cat# CRL-3216 S2 D.melanogaster ATCC Cat# CRL-1963 RPE-hTERT (dTAG-CAF1) (DHB-mVenus, H2B-mTurq2) This manuscript N/A RPE-hTERT (dTAG-CAF1) (p53-KO) (DHB-mVenus, H2B-mTurq2) This manuscript N/A Oligonucleotides RA3 /5rApp/TGGAATTCTCGGGTGCCAAGG/3SpC3/ Integrated DNA Technology N/A RTP GCCTTGGCACCCGAGAATTCCA Integrated DNA Technology N/A CS2 random Hexamer GCCTTGGCACC CGAGAATTCCANNNNNN Integrated DNA Technology N/A EdU-fill in primer ATGCCGGTAATACGACTCAC Integrated DNA Technology N/A ATAC-seq oligos Buenrostro et al.103 N/A H4.2 FISH probe ThermoFisher VA6-3174283-VC siCTRL 50-UGGUUUACAUGUCGACUAA-3 This manuscript N/A siCDKN1A SMARTPool Dharmacon Cat#L-003471-00-0005 Recombinant DNA pUC57 FKBP12F36V GenScript/This manuscript N/A pUC57 V5 - FKBP12F36V GenScript/This manuscript N/A p225a-CHAF1A-Cas9-RNA This manuscript N/A CSII-EF DHB-mVenus Spencer et al.61 Addgene #136461 CSII-EF H2B-mTurquoise Spencer et al.61 N/A pMDLg Dull et al.104 Addgene Cat# 12251 pRSV-Rev Dull et al.104 Addgene Cat# 12253 pCMV-VSV-G Stewart et al.105 Addgene Cat# 8454 Software and algorithms snakePipes Bhardwaj et al.106 PMID: 31134269 DeepTools (v3.1) Ramı́rez et al.107 https://deeptools.readthedocs.io/en/develop Trim-galore (v0.6.5) Babraham Bioinformatics https://www.bioinformatics.babraham.ac.uk/ projects/trim_galore/ Bowtie2 (v2.3) Langmead and Salzberg108 https://bowtie-bio.sourceforge.net/bowtie2/ index.shtml samtools (v1.10) Li et al.109 http://www.htslib.org/ sambamba (v0.7.1) Tarasov et al.110 PMID: 25697820 Seurat (v5.0.1) Stuart et al.111 https://satijalab.org/seurat/ R R Project https://www.r-project.org/ MATLAB (R2020a) MathWorks https://www.mathworks.com/products/ matlab.html FIJI Schindelin et al.112 https://imagej.net/software/fiji (Continued on next page) e4 Molecular Cell 84, 1–18.e1–e10, December 19, 2024

    Article Title: Integrative characterization of MYC RNA-binding function
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER BCA Protein Assay Kit Thermo Scientific Cat# 23225 ECL Western Blotting Substrate Thermo Scientific Cat# 32106 RNA Clean & Concentrator-5 Zymo Research Cat# R1016 DNA Clean & Concentrator-5 Zymo Research Cat# D4014 RNeasy Mini Kit Qiagen Cat# 74104 MinElute Gel Extraction Kit Qiagen Cat# 28604 QIAprep Spin Miniprep Kit Qiagen Cat# 27106 QIAquick PCR Purification Kit Qiagen Cat# 28106 DNeasy Blood &Tissue Kit Qiagen Cat# 69504 Qubit 1× dsDNA HS Assay Kit Invitrogen Cat# Q33231 Qubit Protein BR Assay Kit Invitrogen Cat# A50668 ssDNA Assay Kit Invitrogen Cat# Q10212 Deposited Data eCLIP-seq, endogenous MYC This study GEO: GSE252697 FLAG-MYC eCLIP-seq, MCF-7 This study GEO: GSE200344 MYC/TBP rChIP-seq This study GEO: GSE252695 MYC/TBP rCUT&RUN This study GEO: GSE252694 FLAG-MYC eCLIP-seq, U2OS This study GEO: GSE273775 FLAG-MYC ChIP-Rx This study GEO: GSE252696 MAX ChIP-Rx This study GEO: GSE273776 RNA-seq This study GEO: GSE273777 Unprocessed raw images This study Mendeley Data: https://doi.org/10.17632/3fc4n7j3g9.1 Experimental models: cell lines NIH/3T3 ATCC Cat# CRL-1658; RRID: CVCL_0594 MCF10A ATCC Cat# CRL-10317; RRID: CVCL_0598 K562 ATCC Cat# CCL-243; RRID: CVCL_0004 HepG2 ATCC Cat# HB-8065; RRID: CVCL_0027 U2OS ATCC Cat# HTB-96; RRID: CVCL_0042 HCT116 ATCC Cat# CCL-247; RRID: CVCL_0291 MCF-7 ATCC Cat# HTB-22; RRID: CVCL_0031 HEK293T ATCC Cat# CRL-3216; RRID: CVCL_0063 Oligonucleotides See Table S8 for oligonucleotides This study N/A Recombinant DNA psPAX2 Didier Trono Addgene# 12260 pCMV-VSV-G Stewart et al. 54 Addgene# 8454 pLKO.1 TRC Cloning Vector Moffat et al. 55 Addgene# 10878 pLKO.1 shCtrl This study N/A pLKO.1 shMYC This study N/A pLVX-IRES-hygro Clontech Cat# 632185 pLVX-CMV-Flag-IRES-hygro This study N/A pLVX-Flag-MYC WT shRNA-resistant This study N/A pLVX-Flag-MYC KRR3A shRNA-resistant This study N/A pLVX-Flag-MYC 7A shRNA-resistant This study N/A pLIX_403 David Root Addgene# 41395 pLIX-Flag-MYC WT doxycycline-inducible This study N/A pLIX-Flag-MYC KRR3A doxycycline-inducible This study N/A (Continued on next page) Cell Genomics 5, 100878, July 9, 2025 e3 Article ll OPEN ACCESS

    Article Title: Integrative characterization of MYC RNA-binding function.
    Article Snippet: Human mammary epithelial cell line MCF10A (CRL-10317) was obtained from ATCC and cultured in 1:1 DMEM/F-12 (Gibco, 11320-033) supplemented with 5% horse serum (Gibco, 16050-122), 20 ng/mL human EGF (Peprotech, AF-100-15), 0.5 μg/mL hydrocortisone (Sigma, H0888), 100 ng/mL cholera toxin (Sigma, C8052), 10 μg/mL insulin (Sigma, I1882), and 1% penicillin/streptomycin.

    Article Title: Integrative characterization of MYC RNA-binding function.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER BCA Protein Assay Kit Thermo Scientific Cat# 23225 ECL Western Blotting Substrate Thermo Scientific Cat# 32106 RNA Clean & Concentrator-5 Zymo Research Cat# R1016 DNA Clean & Concentrator-5 Zymo Research Cat# D4014 RNeasy Mini Kit Qiagen Cat# 74104 MinElute Gel Extraction Kit Qiagen Cat# 28604 QIAprep Spin Miniprep Kit Qiagen Cat# 27106 QIAquick PCR Purification Kit Qiagen Cat# 28106 DNeasy Blood &Tissue Kit Qiagen Cat# 69504 Qubit 1× dsDNA HS Assay Kit Invitrogen Cat# Q33231 Qubit Protein BR Assay Kit Invitrogen Cat# A50668 ssDNA Assay Kit Invitrogen Cat# Q10212 Deposited Data eCLIP-seq, endogenous MYC This study GEO: GSE252697 FLAG-MYC eCLIP-seq, MCF-7 This study GEO: GSE200344 MYC/TBP rChIP-seq This study GEO: GSE252695 MYC/TBP rCUT&RUN This study GEO: GSE252694 FLAG-MYC eCLIP-seq, U2OS This study GEO: GSE273775 FLAG-MYC ChIP-Rx This study GEO: GSE252696 MAX ChIP-Rx This study GEO: GSE273776 RNA-seq This study GEO: GSE273777 Unprocessed raw images This study Mendeley Data: https://doi.org/10.17632/3fc4n7j3g9.1 Experimental models: cell lines NIH/3T3 ATCC Cat# CRL-1658; RRID: CVCL_0594 MCF10A ATCC Cat# CRL-10317; RRID: CVCL_0598 K562 ATCC Cat# CCL-243; RRID: CVCL_0004 HepG2 ATCC Cat# HB-8065; RRID: CVCL_0027 U2OS ATCC Cat# HTB-96; RRID: CVCL_0042 HCT116 ATCC Cat# CCL-247; RRID: CVCL_0291 MCF-7 ATCC Cat# HTB-22; RRID: CVCL_0031 HEK293T ATCC Cat# CRL-3216; RRID: CVCL_0063 Oligonucleotides See Table S8 for oligonucleotides This study N/A Recombinant DNA psPAX2 Didier Trono Addgene# 12260 pCMV-VSV-G Stewart et al.54 Addgene# 8454 pLKO.1 TRC Cloning Vector Moffat et al.55 Addgene# 10878 pLKO.1 shCtrl This study N/A pLKO.1 shMYC This study N/A pLVX-IRES-hygro Clontech Cat# 632185 pLVX-CMV-Flag-IRES-hygro This study N/A pLVX-Flag-MYCWT shRNA-resistant This study N/A pLVX-Flag-MYCKRR3A shRNA-resistant This study N/A pLVX-Flag-MYC7A shRNA-resistant This study N/A pLIX_403 David Root Addgene# 41395 pLIX-Flag-MYCWT doxycycline-inducible This study N/A pLIX-Flag-MYCKRR3A doxycycline-inducible This study N/A (Continued on next page) Cell Genomics 5, 100878, July 9, 2025 e3 Article ll OPEN ACCESS

    Recombinant:

    Article Title: Targeting PI3Kδ suppresses pancreatic cancer by dual disruption of fibrosis and immune evasion.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines Human: PANC-1 cell line Dr. John Minna (UT southwestern Medical Center) ATCC #CRL-1469 Human: Hs-766T cell line Dr. John Minna (UT southwestern Medical Center) ATCC #HTB-134 Human: CFPAC-1 cell line Dr. John Minna (UT southwestern Medical Center) ATCC #CRL-1918 Human: SU86.86 cell line Dr. John Minna (UT southwestern Medical Center) ATCC #CRL-1837 Human: AsPC-1 cell line Dr. John Minna (UT southwestern Medical Center) ATCC #CRL-1682 Human: BxPC-3 cell line Dr. John Minna (UT southwestern Medical Center) ATCC #CRL-1687 Human: MIA PaCa-2 cell line Dr. John Minna (UT southwestern Medical Center) ATCC #CRL-1420 Human: HPDE-iKRASG12D cell line Prof. Kenneth Scott, Baylor college of medicine, Houston TX N/A Human: HEK 293T cell line ATCC CRL-11268 Human: 0082T cell line Cancer Research Horizons N/A Mouse embryonic fibroblasts: KrasG12D/WT;p53fl/fl Materials of the GK lab N/A Experimental models: Organisms/strains Mouse: B6.129SS4-krastm4Tyj/J The Jackson Laboratory JAX: 008179, RRID:IMSR_JAX:008179 Mouse: B6.129P2-Trp53tm1Brn/J The Jackson Laboratory JAX: 008462, RRID:IMSR_JAX:008462 Mouse: B6.FVB-Tg(Pdx1-cre) 6Tuv/J The Jackson Laboratory JAX: 014647, RRID:IMSR_JAX:014647 Mouse: NOD-scid IL2Rgnull The Jackson Laboratory JAX: 005557, RRID:IMSR_JAX:005557 Mouse: C57BL/6J Charles River JAX: 632, RRID:IMSR_JAX:000664 Oligonucleotides All used oligonucleotides can be found in Table S1. .. − N/A Recombinant DNA pLKO.1 puro Stewart et al.59 Addgene Plasmid #8453 pLKO.1 hygro Stewart et al.59 Addgene Plasmid #24150 Tet-pLKO-puro Wiederschain et al.60 Addgene plasmid # 21915 pCMV-VSV-G Stewart et al.59 Addgene Plasmid #8454 pMSCV-hygro-Cre Wang et al.61 Addgene Plasmid #34565 pCMV-dR8.2 dvpr Stewart et al.59 Addgene Plasmid #8455 Software and algorithms QuPath v.0.5.0 Bankhead et al.62 https://qupath.github.io/ Imaris Image Analysis Software − http://www.bitplane.com/imaris FlowJo V10 − https://www.flowjo.com/ DepMap portal − https://depmap.org/portal/ GraphPad Prism v.10.4 − https://www.graphpad.com/scientific- software/prism/ Cell Reports 45, 117188, April 28, 2026 19 CAF cell lines used in the study were cultured in Dulbecco’s Modified Eagle medium (DMEM) (Gibco) supplied with 10% FBS and penicillin/streptomycin in an incubator at 37◦C and 5% CO2. .. The cell lines were tested for mycoplasma using the LookOut mycoplasma PCR detection Kit (Sigma, MP0035-1KT).


    Article Title: A thermoplastic chip for 2D and 3D correlative assays combining screening and high-resolution imaging of immune cell responses.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-human CD11a (LFA-1) BioLegend Cat#301202; clone HI111; RRID: AB_314140 Mouse anti-human CD16 BioLegend Cat#302002; clone 3G8; RRID: AB_314202 Mouse anti-human Granzyme B – Alexa Fluor 647 BD Biosciences Cat#560212; clone GB11; RRID: AB_11154033 Mouse anti-human Vimentin – Alexa Fluor 488 Abcam Cat#ab195877 Goat anti-rabbit – Alexa Fluor 488 Abcam Cat#ab150089 Rabbit anti-human PKC-Q Santa Cruz Biotechnology Cat#sc-212; polyclonal C-18 Bacterial and virus strains LeGO-G2-puro https://www.lentigo-vectors. de/vectors.htm LeGO-G2/Puro pMDLg/pRRE Dull et al.54 Addgene #12251 pRSV-Rev Dull et al.54 Addgene #12253 pCMV-VSV-G Stewart et al.55 Addgene #8454 pLenti-CMV-MCS-RFP-SV-puro Jonathan Garlick and Behzad Gerami-Naini Addgene #109377 pLJM1-EGFP Sancak et al.56 Addgene #19319 pJML1-NES-LQDT-mGFP-P2A-NESVGPD-mCherry Beaudouin et al.57 N/A Biological samples Fresh buffy coats from healthy donors Karolinska University Hospital N/A Chemicals, peptides, and recombinant proteins Calcium Phosphate Transfection Kit Sigma-Aldrich CAPHOS Chloroquine Sigma-Aldrich Cat#C6628 Protamine sulfate Sigma-Aldrich Cat#P3369 Puromycin ThermoFisher Scientific Cat#A1113803 Interleukin-2 PeproTech Cat#200-02 Interleukin-15 R&D Systems Cat#247-ILB-005 D-Glucose Sigma-Aldrich Cat#D8375 D-Mannitol Sigma-Aldrich Cat#M4125 L-glutamine Sigma-Aldrich Cat#G7513 Lactic acid Sigma-Aldrich Cat#L6402 Anti-adherence rinsing solution STEMCELL Technologies Cat#07010 BD Pharmingen DRAQ5 BD Biosciences Cat#564902 Abberior LIVE 590 Tubulin Abberior LV590-0141 Phalloidin-STAR Red Abberior STRED-0100 CellTrace Yellow ThermoFisher Scientific Cat#C34567 Cytofix/Cytoperm BD Biosciences Cat#554714 Cytofix BD Biosciences Cat#554655 Perm/Wash BD Bioscences Cat#554714 Histodenz/Omnipaque (iohexol) Apoteket Cat#582692 Critical commercial assays TetraSpeck fluorescent microspheres kit Invitrogen Cat#T7284 Lenti-X Concentrator Takara Cat#631231 EasySep Human NK Cell Isolation Kit STEMCELL Technologies Cat#17955 (Continued on next page) e1 Cell Reports Methods 5, 100965, January 27, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines Human: A498 cell line ATCC HTB-44 Human: OVCAR-8 cell line Gift from Brinton Seashore-Ludlow (Karolinska Institutet, Stockholm, Sweden) N/A Human: DLD-1 cell line ATCC CCL-221 Human: ACHN cell line ATCC CRL-1611 Human: K562 cell line ATCC CCL-243 Human: Jurkat cell line ATCC TIB-152 Human: Nalm-6 cell line DSMZ ACC 128 Human: SUP-B15 cell line Gift from Rozbeh Jafari (Karolinska Institutet, Stockholm, Sweden) N/A Human: Kasumi-1 cell line ATCC CRL-2724 Human: MCF-7 cell line ATCC HTB-22 Human: HeLa cell line ATCC CCL-2 Human: IMR-32 cell line Gift from Jakob Stenman (Karolinska Institutet, Stockholm) N/A Human: A549.Histone.mKate2 cell line Gift from Kalle Malmberg (Oslo University Hospital, Oslo, Norway) N/A Software and algorithms Prism GraphPad https://graphpad.com ImageJ Schneider et al. https://fiji.sc ilastik Berg et al.58 https://www.ilastik.org Imaris Oxford Instruments https://imaris.oxinst.com Moldex3D CoreTech System https://www.moldex3d.com MATLAB 2023B MathWorks https://se.mathworks.com/products/matlab.html measurePSF Rob Campbell https://github.com/SWC-Advanced- Microscopy/measurePSF BioRender BioRender https://biorender.com Image segmentation networks Deep learning Toolbox for resnet50 from MathWorks https://se.mathworks.com/help/ deeplearning/ref/resnet50.html Cell detection scripts for microwell image data This paper https://zenodo.org/records/14507473 https://doi.org/10.5281/zenodo.14507473 OPEN ACCESS

    Plasmid Preparation:

    Article Title: Targeting PI3Kδ suppresses pancreatic cancer by dual disruption of fibrosis and immune evasion.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines Human: PANC-1 cell line Dr. John Minna (UT southwestern Medical Center) ATCC #CRL-1469 Human: Hs-766T cell line Dr. John Minna (UT southwestern Medical Center) ATCC #HTB-134 Human: CFPAC-1 cell line Dr. John Minna (UT southwestern Medical Center) ATCC #CRL-1918 Human: SU86.86 cell line Dr. John Minna (UT southwestern Medical Center) ATCC #CRL-1837 Human: AsPC-1 cell line Dr. John Minna (UT southwestern Medical Center) ATCC #CRL-1682 Human: BxPC-3 cell line Dr. John Minna (UT southwestern Medical Center) ATCC #CRL-1687 Human: MIA PaCa-2 cell line Dr. John Minna (UT southwestern Medical Center) ATCC #CRL-1420 Human: HPDE-iKRASG12D cell line Prof. Kenneth Scott, Baylor college of medicine, Houston TX N/A Human: HEK 293T cell line ATCC CRL-11268 Human: 0082T cell line Cancer Research Horizons N/A Mouse embryonic fibroblasts: KrasG12D/WT;p53fl/fl Materials of the GK lab N/A Experimental models: Organisms/strains Mouse: B6.129SS4-krastm4Tyj/J The Jackson Laboratory JAX: 008179, RRID:IMSR_JAX:008179 Mouse: B6.129P2-Trp53tm1Brn/J The Jackson Laboratory JAX: 008462, RRID:IMSR_JAX:008462 Mouse: B6.FVB-Tg(Pdx1-cre) 6Tuv/J The Jackson Laboratory JAX: 014647, RRID:IMSR_JAX:014647 Mouse: NOD-scid IL2Rgnull The Jackson Laboratory JAX: 005557, RRID:IMSR_JAX:005557 Mouse: C57BL/6J Charles River JAX: 632, RRID:IMSR_JAX:000664 Oligonucleotides All used oligonucleotides can be found in Table S1. .. − N/A Recombinant DNA pLKO.1 puro Stewart et al.59 Addgene Plasmid #8453 pLKO.1 hygro Stewart et al.59 Addgene Plasmid #24150 Tet-pLKO-puro Wiederschain et al.60 Addgene plasmid # 21915 pCMV-VSV-G Stewart et al.59 Addgene Plasmid #8454 pMSCV-hygro-Cre Wang et al.61 Addgene Plasmid #34565 pCMV-dR8.2 dvpr Stewart et al.59 Addgene Plasmid #8455 Software and algorithms QuPath v.0.5.0 Bankhead et al.62 https://qupath.github.io/ Imaris Image Analysis Software − http://www.bitplane.com/imaris FlowJo V10 − https://www.flowjo.com/ DepMap portal − https://depmap.org/portal/ GraphPad Prism v.10.4 − https://www.graphpad.com/scientific- software/prism/ Cell Reports 45, 117188, April 28, 2026 19 CAF cell lines used in the study were cultured in Dulbecco’s Modified Eagle medium (DMEM) (Gibco) supplied with 10% FBS and penicillin/streptomycin in an incubator at 37◦C and 5% CO2. .. The cell lines were tested for mycoplasma using the LookOut mycoplasma PCR detection Kit (Sigma, MP0035-1KT).

    Software:

    Article Title: Targeting PI3Kδ suppresses pancreatic cancer by dual disruption of fibrosis and immune evasion.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines Human: PANC-1 cell line Dr. John Minna (UT southwestern Medical Center) ATCC #CRL-1469 Human: Hs-766T cell line Dr. John Minna (UT southwestern Medical Center) ATCC #HTB-134 Human: CFPAC-1 cell line Dr. John Minna (UT southwestern Medical Center) ATCC #CRL-1918 Human: SU86.86 cell line Dr. John Minna (UT southwestern Medical Center) ATCC #CRL-1837 Human: AsPC-1 cell line Dr. John Minna (UT southwestern Medical Center) ATCC #CRL-1682 Human: BxPC-3 cell line Dr. John Minna (UT southwestern Medical Center) ATCC #CRL-1687 Human: MIA PaCa-2 cell line Dr. John Minna (UT southwestern Medical Center) ATCC #CRL-1420 Human: HPDE-iKRASG12D cell line Prof. Kenneth Scott, Baylor college of medicine, Houston TX N/A Human: HEK 293T cell line ATCC CRL-11268 Human: 0082T cell line Cancer Research Horizons N/A Mouse embryonic fibroblasts: KrasG12D/WT;p53fl/fl Materials of the GK lab N/A Experimental models: Organisms/strains Mouse: B6.129SS4-krastm4Tyj/J The Jackson Laboratory JAX: 008179, RRID:IMSR_JAX:008179 Mouse: B6.129P2-Trp53tm1Brn/J The Jackson Laboratory JAX: 008462, RRID:IMSR_JAX:008462 Mouse: B6.FVB-Tg(Pdx1-cre) 6Tuv/J The Jackson Laboratory JAX: 014647, RRID:IMSR_JAX:014647 Mouse: NOD-scid IL2Rgnull The Jackson Laboratory JAX: 005557, RRID:IMSR_JAX:005557 Mouse: C57BL/6J Charles River JAX: 632, RRID:IMSR_JAX:000664 Oligonucleotides All used oligonucleotides can be found in Table S1. .. − N/A Recombinant DNA pLKO.1 puro Stewart et al.59 Addgene Plasmid #8453 pLKO.1 hygro Stewart et al.59 Addgene Plasmid #24150 Tet-pLKO-puro Wiederschain et al.60 Addgene plasmid # 21915 pCMV-VSV-G Stewart et al.59 Addgene Plasmid #8454 pMSCV-hygro-Cre Wang et al.61 Addgene Plasmid #34565 pCMV-dR8.2 dvpr Stewart et al.59 Addgene Plasmid #8455 Software and algorithms QuPath v.0.5.0 Bankhead et al.62 https://qupath.github.io/ Imaris Image Analysis Software − http://www.bitplane.com/imaris FlowJo V10 − https://www.flowjo.com/ DepMap portal − https://depmap.org/portal/ GraphPad Prism v.10.4 − https://www.graphpad.com/scientific- software/prism/ Cell Reports 45, 117188, April 28, 2026 19 CAF cell lines used in the study were cultured in Dulbecco’s Modified Eagle medium (DMEM) (Gibco) supplied with 10% FBS and penicillin/streptomycin in an incubator at 37◦C and 5% CO2. .. The cell lines were tested for mycoplasma using the LookOut mycoplasma PCR detection Kit (Sigma, MP0035-1KT).


    Cell Culture:

    Article Title: Targeting PI3Kδ suppresses pancreatic cancer by dual disruption of fibrosis and immune evasion.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines Human: PANC-1 cell line Dr. John Minna (UT southwestern Medical Center) ATCC #CRL-1469 Human: Hs-766T cell line Dr. John Minna (UT southwestern Medical Center) ATCC #HTB-134 Human: CFPAC-1 cell line Dr. John Minna (UT southwestern Medical Center) ATCC #CRL-1918 Human: SU86.86 cell line Dr. John Minna (UT southwestern Medical Center) ATCC #CRL-1837 Human: AsPC-1 cell line Dr. John Minna (UT southwestern Medical Center) ATCC #CRL-1682 Human: BxPC-3 cell line Dr. John Minna (UT southwestern Medical Center) ATCC #CRL-1687 Human: MIA PaCa-2 cell line Dr. John Minna (UT southwestern Medical Center) ATCC #CRL-1420 Human: HPDE-iKRASG12D cell line Prof. Kenneth Scott, Baylor college of medicine, Houston TX N/A Human: HEK 293T cell line ATCC CRL-11268 Human: 0082T cell line Cancer Research Horizons N/A Mouse embryonic fibroblasts: KrasG12D/WT;p53fl/fl Materials of the GK lab N/A Experimental models: Organisms/strains Mouse: B6.129SS4-krastm4Tyj/J The Jackson Laboratory JAX: 008179, RRID:IMSR_JAX:008179 Mouse: B6.129P2-Trp53tm1Brn/J The Jackson Laboratory JAX: 008462, RRID:IMSR_JAX:008462 Mouse: B6.FVB-Tg(Pdx1-cre) 6Tuv/J The Jackson Laboratory JAX: 014647, RRID:IMSR_JAX:014647 Mouse: NOD-scid IL2Rgnull The Jackson Laboratory JAX: 005557, RRID:IMSR_JAX:005557 Mouse: C57BL/6J Charles River JAX: 632, RRID:IMSR_JAX:000664 Oligonucleotides All used oligonucleotides can be found in Table S1. .. − N/A Recombinant DNA pLKO.1 puro Stewart et al.59 Addgene Plasmid #8453 pLKO.1 hygro Stewart et al.59 Addgene Plasmid #24150 Tet-pLKO-puro Wiederschain et al.60 Addgene plasmid # 21915 pCMV-VSV-G Stewart et al.59 Addgene Plasmid #8454 pMSCV-hygro-Cre Wang et al.61 Addgene Plasmid #34565 pCMV-dR8.2 dvpr Stewart et al.59 Addgene Plasmid #8455 Software and algorithms QuPath v.0.5.0 Bankhead et al.62 https://qupath.github.io/ Imaris Image Analysis Software − http://www.bitplane.com/imaris FlowJo V10 − https://www.flowjo.com/ DepMap portal − https://depmap.org/portal/ GraphPad Prism v.10.4 − https://www.graphpad.com/scientific- software/prism/ Cell Reports 45, 117188, April 28, 2026 19 CAF cell lines used in the study were cultured in Dulbecco’s Modified Eagle medium (DMEM) (Gibco) supplied with 10% FBS and penicillin/streptomycin in an incubator at 37◦C and 5% CO2. .. The cell lines were tested for mycoplasma using the LookOut mycoplasma PCR detection Kit (Sigma, MP0035-1KT).

    Modification:

    Article Title: Targeting PI3Kδ suppresses pancreatic cancer by dual disruption of fibrosis and immune evasion.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines Human: PANC-1 cell line Dr. John Minna (UT southwestern Medical Center) ATCC #CRL-1469 Human: Hs-766T cell line Dr. John Minna (UT southwestern Medical Center) ATCC #HTB-134 Human: CFPAC-1 cell line Dr. John Minna (UT southwestern Medical Center) ATCC #CRL-1918 Human: SU86.86 cell line Dr. John Minna (UT southwestern Medical Center) ATCC #CRL-1837 Human: AsPC-1 cell line Dr. John Minna (UT southwestern Medical Center) ATCC #CRL-1682 Human: BxPC-3 cell line Dr. John Minna (UT southwestern Medical Center) ATCC #CRL-1687 Human: MIA PaCa-2 cell line Dr. John Minna (UT southwestern Medical Center) ATCC #CRL-1420 Human: HPDE-iKRASG12D cell line Prof. Kenneth Scott, Baylor college of medicine, Houston TX N/A Human: HEK 293T cell line ATCC CRL-11268 Human: 0082T cell line Cancer Research Horizons N/A Mouse embryonic fibroblasts: KrasG12D/WT;p53fl/fl Materials of the GK lab N/A Experimental models: Organisms/strains Mouse: B6.129SS4-krastm4Tyj/J The Jackson Laboratory JAX: 008179, RRID:IMSR_JAX:008179 Mouse: B6.129P2-Trp53tm1Brn/J The Jackson Laboratory JAX: 008462, RRID:IMSR_JAX:008462 Mouse: B6.FVB-Tg(Pdx1-cre) 6Tuv/J The Jackson Laboratory JAX: 014647, RRID:IMSR_JAX:014647 Mouse: NOD-scid IL2Rgnull The Jackson Laboratory JAX: 005557, RRID:IMSR_JAX:005557 Mouse: C57BL/6J Charles River JAX: 632, RRID:IMSR_JAX:000664 Oligonucleotides All used oligonucleotides can be found in Table S1. .. − N/A Recombinant DNA pLKO.1 puro Stewart et al.59 Addgene Plasmid #8453 pLKO.1 hygro Stewart et al.59 Addgene Plasmid #24150 Tet-pLKO-puro Wiederschain et al.60 Addgene plasmid # 21915 pCMV-VSV-G Stewart et al.59 Addgene Plasmid #8454 pMSCV-hygro-Cre Wang et al.61 Addgene Plasmid #34565 pCMV-dR8.2 dvpr Stewart et al.59 Addgene Plasmid #8455 Software and algorithms QuPath v.0.5.0 Bankhead et al.62 https://qupath.github.io/ Imaris Image Analysis Software − http://www.bitplane.com/imaris FlowJo V10 − https://www.flowjo.com/ DepMap portal − https://depmap.org/portal/ GraphPad Prism v.10.4 − https://www.graphpad.com/scientific- software/prism/ Cell Reports 45, 117188, April 28, 2026 19 CAF cell lines used in the study were cultured in Dulbecco’s Modified Eagle medium (DMEM) (Gibco) supplied with 10% FBS and penicillin/streptomycin in an incubator at 37◦C and 5% CO2. .. The cell lines were tested for mycoplasma using the LookOut mycoplasma PCR detection Kit (Sigma, MP0035-1KT).

    Infection:


    Virus:

    Article Title: A thermoplastic chip for 2D and 3D correlative assays combining screening and high-resolution imaging of immune cell responses.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-human CD11a (LFA-1) BioLegend Cat#301202; clone HI111; RRID: AB_314140 Mouse anti-human CD16 BioLegend Cat#302002; clone 3G8; RRID: AB_314202 Mouse anti-human Granzyme B – Alexa Fluor 647 BD Biosciences Cat#560212; clone GB11; RRID: AB_11154033 Mouse anti-human Vimentin – Alexa Fluor 488 Abcam Cat#ab195877 Goat anti-rabbit – Alexa Fluor 488 Abcam Cat#ab150089 Rabbit anti-human PKC-Q Santa Cruz Biotechnology Cat#sc-212; polyclonal C-18 Bacterial and virus strains LeGO-G2-puro https://www.lentigo-vectors. de/vectors.htm LeGO-G2/Puro pMDLg/pRRE Dull et al.54 Addgene #12251 pRSV-Rev Dull et al.54 Addgene #12253 pCMV-VSV-G Stewart et al.55 Addgene #8454 pLenti-CMV-MCS-RFP-SV-puro Jonathan Garlick and Behzad Gerami-Naini Addgene #109377 pLJM1-EGFP Sancak et al.56 Addgene #19319 pJML1-NES-LQDT-mGFP-P2A-NESVGPD-mCherry Beaudouin et al.57 N/A Biological samples Fresh buffy coats from healthy donors Karolinska University Hospital N/A Chemicals, peptides, and recombinant proteins Calcium Phosphate Transfection Kit Sigma-Aldrich CAPHOS Chloroquine Sigma-Aldrich Cat#C6628 Protamine sulfate Sigma-Aldrich Cat#P3369 Puromycin ThermoFisher Scientific Cat#A1113803 Interleukin-2 PeproTech Cat#200-02 Interleukin-15 R&D Systems Cat#247-ILB-005 D-Glucose Sigma-Aldrich Cat#D8375 D-Mannitol Sigma-Aldrich Cat#M4125 L-glutamine Sigma-Aldrich Cat#G7513 Lactic acid Sigma-Aldrich Cat#L6402 Anti-adherence rinsing solution STEMCELL Technologies Cat#07010 BD Pharmingen DRAQ5 BD Biosciences Cat#564902 Abberior LIVE 590 Tubulin Abberior LV590-0141 Phalloidin-STAR Red Abberior STRED-0100 CellTrace Yellow ThermoFisher Scientific Cat#C34567 Cytofix/Cytoperm BD Biosciences Cat#554714 Cytofix BD Biosciences Cat#554655 Perm/Wash BD Bioscences Cat#554714 Histodenz/Omnipaque (iohexol) Apoteket Cat#582692 Critical commercial assays TetraSpeck fluorescent microspheres kit Invitrogen Cat#T7284 Lenti-X Concentrator Takara Cat#631231 EasySep Human NK Cell Isolation Kit STEMCELL Technologies Cat#17955 (Continued on next page) e1 Cell Reports Methods 5, 100965, January 27, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines Human: A498 cell line ATCC HTB-44 Human: OVCAR-8 cell line Gift from Brinton Seashore-Ludlow (Karolinska Institutet, Stockholm, Sweden) N/A Human: DLD-1 cell line ATCC CCL-221 Human: ACHN cell line ATCC CRL-1611 Human: K562 cell line ATCC CCL-243 Human: Jurkat cell line ATCC TIB-152 Human: Nalm-6 cell line DSMZ ACC 128 Human: SUP-B15 cell line Gift from Rozbeh Jafari (Karolinska Institutet, Stockholm, Sweden) N/A Human: Kasumi-1 cell line ATCC CRL-2724 Human: MCF-7 cell line ATCC HTB-22 Human: HeLa cell line ATCC CCL-2 Human: IMR-32 cell line Gift from Jakob Stenman (Karolinska Institutet, Stockholm) N/A Human: A549.Histone.mKate2 cell line Gift from Kalle Malmberg (Oslo University Hospital, Oslo, Norway) N/A Software and algorithms Prism GraphPad https://graphpad.com ImageJ Schneider et al. https://fiji.sc ilastik Berg et al.58 https://www.ilastik.org Imaris Oxford Instruments https://imaris.oxinst.com Moldex3D CoreTech System https://www.moldex3d.com MATLAB 2023B MathWorks https://se.mathworks.com/products/matlab.html measurePSF Rob Campbell https://github.com/SWC-Advanced- Microscopy/measurePSF BioRender BioRender https://biorender.com Image segmentation networks Deep learning Toolbox for resnet50 from MathWorks https://se.mathworks.com/help/ deeplearning/ref/resnet50.html Cell detection scripts for microwell image data This paper https://zenodo.org/records/14507473 https://doi.org/10.5281/zenodo.14507473 OPEN ACCESS

    Transfection:

    Article Title: A thermoplastic chip for 2D and 3D correlative assays combining screening and high-resolution imaging of immune cell responses.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-human CD11a (LFA-1) BioLegend Cat#301202; clone HI111; RRID: AB_314140 Mouse anti-human CD16 BioLegend Cat#302002; clone 3G8; RRID: AB_314202 Mouse anti-human Granzyme B – Alexa Fluor 647 BD Biosciences Cat#560212; clone GB11; RRID: AB_11154033 Mouse anti-human Vimentin – Alexa Fluor 488 Abcam Cat#ab195877 Goat anti-rabbit – Alexa Fluor 488 Abcam Cat#ab150089 Rabbit anti-human PKC-Q Santa Cruz Biotechnology Cat#sc-212; polyclonal C-18 Bacterial and virus strains LeGO-G2-puro https://www.lentigo-vectors. de/vectors.htm LeGO-G2/Puro pMDLg/pRRE Dull et al.54 Addgene #12251 pRSV-Rev Dull et al.54 Addgene #12253 pCMV-VSV-G Stewart et al.55 Addgene #8454 pLenti-CMV-MCS-RFP-SV-puro Jonathan Garlick and Behzad Gerami-Naini Addgene #109377 pLJM1-EGFP Sancak et al.56 Addgene #19319 pJML1-NES-LQDT-mGFP-P2A-NESVGPD-mCherry Beaudouin et al.57 N/A Biological samples Fresh buffy coats from healthy donors Karolinska University Hospital N/A Chemicals, peptides, and recombinant proteins Calcium Phosphate Transfection Kit Sigma-Aldrich CAPHOS Chloroquine Sigma-Aldrich Cat#C6628 Protamine sulfate Sigma-Aldrich Cat#P3369 Puromycin ThermoFisher Scientific Cat#A1113803 Interleukin-2 PeproTech Cat#200-02 Interleukin-15 R&D Systems Cat#247-ILB-005 D-Glucose Sigma-Aldrich Cat#D8375 D-Mannitol Sigma-Aldrich Cat#M4125 L-glutamine Sigma-Aldrich Cat#G7513 Lactic acid Sigma-Aldrich Cat#L6402 Anti-adherence rinsing solution STEMCELL Technologies Cat#07010 BD Pharmingen DRAQ5 BD Biosciences Cat#564902 Abberior LIVE 590 Tubulin Abberior LV590-0141 Phalloidin-STAR Red Abberior STRED-0100 CellTrace Yellow ThermoFisher Scientific Cat#C34567 Cytofix/Cytoperm BD Biosciences Cat#554714 Cytofix BD Biosciences Cat#554655 Perm/Wash BD Bioscences Cat#554714 Histodenz/Omnipaque (iohexol) Apoteket Cat#582692 Critical commercial assays TetraSpeck fluorescent microspheres kit Invitrogen Cat#T7284 Lenti-X Concentrator Takara Cat#631231 EasySep Human NK Cell Isolation Kit STEMCELL Technologies Cat#17955 (Continued on next page) e1 Cell Reports Methods 5, 100965, January 27, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines Human: A498 cell line ATCC HTB-44 Human: OVCAR-8 cell line Gift from Brinton Seashore-Ludlow (Karolinska Institutet, Stockholm, Sweden) N/A Human: DLD-1 cell line ATCC CCL-221 Human: ACHN cell line ATCC CRL-1611 Human: K562 cell line ATCC CCL-243 Human: Jurkat cell line ATCC TIB-152 Human: Nalm-6 cell line DSMZ ACC 128 Human: SUP-B15 cell line Gift from Rozbeh Jafari (Karolinska Institutet, Stockholm, Sweden) N/A Human: Kasumi-1 cell line ATCC CRL-2724 Human: MCF-7 cell line ATCC HTB-22 Human: HeLa cell line ATCC CCL-2 Human: IMR-32 cell line Gift from Jakob Stenman (Karolinska Institutet, Stockholm) N/A Human: A549.Histone.mKate2 cell line Gift from Kalle Malmberg (Oslo University Hospital, Oslo, Norway) N/A Software and algorithms Prism GraphPad https://graphpad.com ImageJ Schneider et al. https://fiji.sc ilastik Berg et al.58 https://www.ilastik.org Imaris Oxford Instruments https://imaris.oxinst.com Moldex3D CoreTech System https://www.moldex3d.com MATLAB 2023B MathWorks https://se.mathworks.com/products/matlab.html measurePSF Rob Campbell https://github.com/SWC-Advanced- Microscopy/measurePSF BioRender BioRender https://biorender.com Image segmentation networks Deep learning Toolbox for resnet50 from MathWorks https://se.mathworks.com/help/ deeplearning/ref/resnet50.html Cell detection scripts for microwell image data This paper https://zenodo.org/records/14507473 https://doi.org/10.5281/zenodo.14507473 OPEN ACCESS

    Cell Isolation:

    Article Title: A thermoplastic chip for 2D and 3D correlative assays combining screening and high-resolution imaging of immune cell responses.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-human CD11a (LFA-1) BioLegend Cat#301202; clone HI111; RRID: AB_314140 Mouse anti-human CD16 BioLegend Cat#302002; clone 3G8; RRID: AB_314202 Mouse anti-human Granzyme B – Alexa Fluor 647 BD Biosciences Cat#560212; clone GB11; RRID: AB_11154033 Mouse anti-human Vimentin – Alexa Fluor 488 Abcam Cat#ab195877 Goat anti-rabbit – Alexa Fluor 488 Abcam Cat#ab150089 Rabbit anti-human PKC-Q Santa Cruz Biotechnology Cat#sc-212; polyclonal C-18 Bacterial and virus strains LeGO-G2-puro https://www.lentigo-vectors. de/vectors.htm LeGO-G2/Puro pMDLg/pRRE Dull et al.54 Addgene #12251 pRSV-Rev Dull et al.54 Addgene #12253 pCMV-VSV-G Stewart et al.55 Addgene #8454 pLenti-CMV-MCS-RFP-SV-puro Jonathan Garlick and Behzad Gerami-Naini Addgene #109377 pLJM1-EGFP Sancak et al.56 Addgene #19319 pJML1-NES-LQDT-mGFP-P2A-NESVGPD-mCherry Beaudouin et al.57 N/A Biological samples Fresh buffy coats from healthy donors Karolinska University Hospital N/A Chemicals, peptides, and recombinant proteins Calcium Phosphate Transfection Kit Sigma-Aldrich CAPHOS Chloroquine Sigma-Aldrich Cat#C6628 Protamine sulfate Sigma-Aldrich Cat#P3369 Puromycin ThermoFisher Scientific Cat#A1113803 Interleukin-2 PeproTech Cat#200-02 Interleukin-15 R&D Systems Cat#247-ILB-005 D-Glucose Sigma-Aldrich Cat#D8375 D-Mannitol Sigma-Aldrich Cat#M4125 L-glutamine Sigma-Aldrich Cat#G7513 Lactic acid Sigma-Aldrich Cat#L6402 Anti-adherence rinsing solution STEMCELL Technologies Cat#07010 BD Pharmingen DRAQ5 BD Biosciences Cat#564902 Abberior LIVE 590 Tubulin Abberior LV590-0141 Phalloidin-STAR Red Abberior STRED-0100 CellTrace Yellow ThermoFisher Scientific Cat#C34567 Cytofix/Cytoperm BD Biosciences Cat#554714 Cytofix BD Biosciences Cat#554655 Perm/Wash BD Bioscences Cat#554714 Histodenz/Omnipaque (iohexol) Apoteket Cat#582692 Critical commercial assays TetraSpeck fluorescent microspheres kit Invitrogen Cat#T7284 Lenti-X Concentrator Takara Cat#631231 EasySep Human NK Cell Isolation Kit STEMCELL Technologies Cat#17955 (Continued on next page) e1 Cell Reports Methods 5, 100965, January 27, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines Human: A498 cell line ATCC HTB-44 Human: OVCAR-8 cell line Gift from Brinton Seashore-Ludlow (Karolinska Institutet, Stockholm, Sweden) N/A Human: DLD-1 cell line ATCC CCL-221 Human: ACHN cell line ATCC CRL-1611 Human: K562 cell line ATCC CCL-243 Human: Jurkat cell line ATCC TIB-152 Human: Nalm-6 cell line DSMZ ACC 128 Human: SUP-B15 cell line Gift from Rozbeh Jafari (Karolinska Institutet, Stockholm, Sweden) N/A Human: Kasumi-1 cell line ATCC CRL-2724 Human: MCF-7 cell line ATCC HTB-22 Human: HeLa cell line ATCC CCL-2 Human: IMR-32 cell line Gift from Jakob Stenman (Karolinska Institutet, Stockholm) N/A Human: A549.Histone.mKate2 cell line Gift from Kalle Malmberg (Oslo University Hospital, Oslo, Norway) N/A Software and algorithms Prism GraphPad https://graphpad.com ImageJ Schneider et al. https://fiji.sc ilastik Berg et al.58 https://www.ilastik.org Imaris Oxford Instruments https://imaris.oxinst.com Moldex3D CoreTech System https://www.moldex3d.com MATLAB 2023B MathWorks https://se.mathworks.com/products/matlab.html measurePSF Rob Campbell https://github.com/SWC-Advanced- Microscopy/measurePSF BioRender BioRender https://biorender.com Image segmentation networks Deep learning Toolbox for resnet50 from MathWorks https://se.mathworks.com/help/ deeplearning/ref/resnet50.html Cell detection scripts for microwell image data This paper https://zenodo.org/records/14507473 https://doi.org/10.5281/zenodo.14507473 OPEN ACCESS



    Similar Products

    pcmv vsv g stewart  (Addgene inc)
    96
    Addgene inc pcmv vsv g stewart
    Pcmv Vsv G Stewart, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcmv+vsv+g+stewart/pCMV-VSV-G+(Plasmid+%238454)/pm41915470-258-28-32
    Average 96 stars, based on 1 article reviews
    pcmv vsv g stewart - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    pcmv vsv g packaging plasmid stewart  (Addgene inc)
    96
    Addgene inc pcmv vsv g packaging plasmid stewart
    Pcmv Vsv G Packaging Plasmid Stewart, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcmv+vsv+g+stewart/pCMV-VSV-G+(Plasmid+%238454)/pm39954255-143-42-48
    Average 96 stars, based on 1 article reviews
    pcmv vsv g packaging plasmid stewart - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier

    Image Search Results